Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_14623 | |||
Gene | n/a | Organism | Human |
Genome Locus | chr19:30547942-30549514:n/a | Build | hg19 |
Disease | Pulmonary Tuberculosis | ICD-10 | Respiratory tuberculosis, bacteriologically and histologically confirmed (A15) |
DBLink | Link to database | PMID | 29371930 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | Fasting whole blood samples were collected from the Pulmonary Tuberculosis (PTB) patients and healthy individuals |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAATGCAGTTTCCTTCCTCTC ReverseGGCTGAATTGATAGAGAATGG | Statistics | Fold Change : Upregulated,10.62873673 pvalue : p<0.05 |
Citation | |||
Zhang, X, Zhu, M, Yang, R, Zhao, W, Hu, X, Gan, J (2017). Identification and comparison of novel circular RNAs with associated co-expression and competing endogenous RNA networks in pulmonary tuberculosis. Oncotarget, 8, 69:113571-113582. |